Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.033260 |
Chromosome: | chromosome 1 |
Location: | 2518662 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g014850 | (1 of 1) PTHR12281//PTHR12281:SF2 - RP42 RELATED // DCN1-LIKE PROTEIN 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCAAAACGTTGCAGCAATAGGCACACGAGTACGCACAGGGATGTGTA |
Internal bar code: | GGTCGCTCTAGTATACCGCGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1944 |
LEAP-Seq percent confirming: | 97.1429 |
LEAP-Seq n confirming: | 34 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCGCAGAAGGGCCAGAAAT |
Suggested primer 2: | GTCCTGACTGTCCTCGCAAA |