| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.033274 |
| Chromosome: | chromosome 6 |
| Location: | 1133233 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g257800 | POL1B,POL1-1 | (1 of 2) IPR001098//IPR002298 - DNA-directed DNA polymerase, family A, palm domain // DNA polymerase A; DNA polymerase I, probably mitochondrial | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGAACACGTCGCCGCCCGACCTCAGCAGCTGCTGCAGCCGCATGTCGCC |
| Internal bar code: | GGGAAATCGCCATCTATGCACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1775 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 57 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGGTCCTGGCACCTGAAA |
| Suggested primer 2: | CTCACACACTCACGCTCAGT |