| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.033283 |
| Chromosome: | chromosome 9 |
| Location: | 6535954 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g415900 | TPT15,MOT20 | UMAMIT (Usually Multiple Acids Move In and Out Transporters) type transporter; (1 of 2) PF03151//PF08449 - Triose-phosphate Transporter family (TPT) // UAA transporter family (UAA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTGTCGTGAGCAAACAGCAGTATGCAGCCAACAATATCGCTCCTCTCC |
| Internal bar code: | GGTTTTCAGGGAAGAGTTGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1917 |
| LEAP-Seq percent confirming: | 95.7447 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACCTGCCCTAGTTCCATT |
| Suggested primer 2: | CGCAAGAATGAGCCAATCGG |