| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.033367 |
| Chromosome: | chromosome 12 |
| Location: | 1158340 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g490800 | (1 of 6) IPR000104//IPR000719//IPR002290//IPR011009//IPR020635 - Antifreeze protein, type I // Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAGATGAGGATGTTGCTGGGCTTAATGTCCCTGCAGCAACAGCAACAG |
| Internal bar code: | CGGGGTATTTACTTTAAGCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1227 |
| LEAP-Seq percent confirming: | 95.2381 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCCGTTCCTTCGTTCCAG |
| Suggested primer 2: | TAAGCAAGGCATGACCAGCA |