| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.033454 |
| Chromosome: | chromosome 1 |
| Location: | 4168325 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g027850 | NUOAF2 | (1 of 1) PTHR13194//PTHR13194:SF7 - COMPLEX I INTERMEDIATE-ASSOCIATED PROTEIN 30 // SUBFAMILY NOT NAMED; Complex I intermediate-associated CIA30 protein, mitochondrial | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATCACATGCCCCACTCGCCCAAACCGCCGCGCCGCGACTCGCCAGACG |
| Internal bar code: | TACTGACTTTAAGAAGGGGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2827 |
| LEAP-Seq percent confirming: | 98.4615 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGGACACCTGCACAAAGC |
| Suggested primer 2: | ACCGTGGCAAAATCAAGTGC |