| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.033502 |
| Chromosome: | chromosome 1 |
| Location: | 4646193 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g032150 | FAP187 | (1 of 2) PTHR22847//PTHR22847:SF442 - WD40 REPEAT PROTEIN // SUBFAMILY NOT NAMED; Flagellar Associated Protein 187 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACGGCTCGGCAGTTACACTCCAGCCACACTCCCCGGGGGCCGCCAGCC |
| Internal bar code: | GTTTTTGTAGTTTTCGCGTGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1658 |
| LEAP-Seq percent confirming: | 94.6429 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCAACGGAAACAACAGTC |
| Suggested primer 2: | TGTACTCCACGTTGAACCGG |