Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.033599 |
Chromosome: | chromosome 17 |
Location: | 5292228 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g802109 | intron | ||
Cre17.g802110 | (1 of 20) PF01822 - WSC domain (WSC) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCTGCTGCAAGCCCAGGGGCAAGCCCACGCCCTCAGACCCGTCCCTTG |
Internal bar code: | TGGGCTACCAGAATACGTGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1566 |
LEAP-Seq percent confirming: | 28.125 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATCAGTCATACGCTCGCC |
Suggested primer 2: | ATTCCTGTTACCCCTGCAGC |