| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.033655 |
| Chromosome: | chromosome 1 |
| Location: | 1437648 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g007651 | PUS10 | (1 of 1) 5.4.99.27 - tRNA pseudouridine(13) synthase / tRNA Psi(13) synthase; RNA pseudouridine synthase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGCCGCCGGCAGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG |
| Internal bar code: | TGTGGAGGATTCATTCACTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 608 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAACGCAACCCCTCCCTTC |
| Suggested primer 2: | GTGACTGCGTGTGTGTGAAC |