Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.033665 |
Chromosome: | chromosome 9 |
Location: | 6648349 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g416450 | (1 of 14) PF04577 - Protein of unknown function (DUF563) (DUF563) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGAATCCCCTGTCCGCTGGCTGGCCTTTCGCTGGGGGTGTCGGCAGGTG |
Internal bar code: | CCAGAAGAGATGTGATCGACAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3620 |
LEAP-Seq percent confirming: | 85.2273 |
LEAP-Seq n confirming: | 75 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 88 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTCAGTGAGTGAAGTGGA |
Suggested primer 2: | CGACGTACCATAGGCCTGAC |