Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.033696 |
Chromosome: | chromosome 3 |
Location: | 2875933 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g162366 | (1 of 2) 1.10.3.3 - L-ascorbate oxidase / Ascorbase | 3'UTR_intron | |
Cre03.g162400 | HEATR2B,HTR2B,DNAAF5 | (1 of 1) IPR011989//IPR016024//IPR021133 - Armadillo-like helical // Armadillo-type fold // HEAT, type 2; 5-Hydroxytryptamine Receptor 2B | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTTTTACGGCGACGACCTCAAGGTAGGGCCTCGCTGTGTGTGTTGGGG |
Internal bar code: | ACCAGCCGAGCGTCACCGCGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 631 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCTTGCCGCAGAAGTTCA |
Suggested primer 2: | TGTGGATGAGTGTCACGTGG |