| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.033721 |
| Chromosome: | chromosome 2 |
| Location: | 7273461 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391319 | (1 of 102) PF01753 - MYND finger (zf-MYND) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCATTGACACCTGCTCTGACTGGCGCCTTCGCAAGCGTCCTGCATTGCC |
| Internal bar code: | TAAAATCGTCGTAATTCATGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4785 |
| LEAP-Seq percent confirming: | 76.5957 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCTAAACAACCCTGGCAT |
| Suggested primer 2: | CAATAACAATCCCAGCGCGG |