| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.033724 |
| Chromosome: | chromosome 2 |
| Location: | 60629 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g073400 | (1 of 1) K01410 - mitochondrial intermediate peptidase [EC:3.4.24.59] (MIPEP) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCACCCACTGCCTGCAGCCTACATCTCCCGGGTCAACGCGCACACGGGC |
| Internal bar code: | CGGATCCTTCGCTGATGGCACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2016 |
| LEAP-Seq percent confirming: | 92.5926 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGAAACAGTACGCCAGGA |
| Suggested primer 2: | CCGTTGCCCTGGATACTTGT |