| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.033738 |
| Chromosome: | chromosome 17 |
| Location: | 140179 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g696850 | POB16 | Proteome of basal body 16; (1 of 2) K17279 - receptor expression-enhancing protein 5/6 (REEP5_6) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCTCCCAGCCATCCAGCACACGGTCAGCTCGCACTCCTGAGCACGCA |
| Internal bar code: | CGGATTCAAGTCGAGGCTTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4419 |
| LEAP-Seq percent confirming: | 89.6104 |
| LEAP-Seq n confirming: | 69 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTTGCACATCCACAGCAA |
| Suggested primer 2: | CACGGACAAGGGTTCCTGAA |