Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.033910 |
Chromosome: | chromosome 12 |
Location: | 6972686 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g561101 | ELG42 | Exostosin-like glycosyltransferase 42; (1 of 6) IPR000742//IPR004263//IPR009030 - EGF-like domain // Exostosin-like // Insulin-like growth factor binding protein, N-terminal | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCTCGTCAATCTGCCGGTAGGTCTCCGGGGCCGCGTCCGGGTGCTCCG |
Internal bar code: | CCAGCATCAGGCTATACCGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1393 |
LEAP-Seq percent confirming: | 35.4839 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGCAGGTGTGTGTTGCAG |
Suggested primer 2: | GTGCCTAGTTTTTGCGCACA |