| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.033953 |
| Chromosome: | chromosome 10 |
| Location: | 278025 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g419550 | (1 of 1) PTHR28141//PTHR28141:SF1 - FAMILY NOT NAMED // 2',3'-CYCLIC-NUCLEOTIDE 3'-PHOSPHODIESTERASE | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGTTCCTCCCGCCTGCTCCCGCTGCCGTGCCCTACGCCGCGACATGCA |
| Internal bar code: | AGGTGGAAAAAACTGTTTGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5202 |
| LEAP-Seq percent confirming: | 72.2892 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 83 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACATTGCACAAACGTGGC |
| Suggested primer 2: | CACGTATGCATGGTGCTTCG |