| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.033957 |
| Chromosome: | chromosome 7 |
| Location: | 5230423 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g349152 | (1 of 2) IPR000104//IPR011598 - Antifreeze protein, type I // Myc-type, basic helix-loop-helix (bHLH) domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCACCTGCAGCACCTGCACCTGCAGCAGCAGCAGGCGCTGCACCAGA |
| Internal bar code: | GGCGACACATAAGAGAGCCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 778 |
| LEAP-Seq percent confirming: | 85.0 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAGCTAGCTCAAGTCACC |
| Suggested primer 2: | CACACCGCCAGTTGTTGAAG |