Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.033972 |
Chromosome: | chromosome 17 |
Location: | 1091065 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g703800 | DUR32,DUR3C,DUR5 | Urea active transporter; (1 of 3) PTHR11819:SF94 - SODIUM-DEPENDENT MULTIVITAMIN TRANSPORTER-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCATCCGCACTACCGTACCCGCGCTATGGGGCCCTGGACACACACCAAC |
Internal bar code: | GTGGTCAGGTTAGTCGGGTCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 72 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTGGAAACCGTAGTCACCA |
Suggested primer 2: | TCACACCTACACTCGCACAC |