Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.034005 |
Chromosome: | chromosome 2 |
Location: | 2195985 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g089608 | (1 of 1) K11136 - regulator of telomere elongation helicase 1 [EC:3.6.4.12] (RTEL1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGCCGAACGGCAGCACACCCACCCACACCTGGACAGGGGCAGCAGCA |
Internal bar code: | CCCGCGCAAATAGACCACATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 411 |
LEAP-Seq percent confirming: | 95.8333 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCCTCCCCTTTCGGATGAT |
Suggested primer 2: | GAGGTGGGGAGAAGGGAGAT |