| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.034016 |
| Chromosome: | chromosome 3 |
| Location: | 5648234 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g186300 | DII2,FAP146,p38 | p38 protein Associated with Inner Arm Dynein d; (1 of 26) IPR011990 - Tetratricopeptide-like helical domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGCTATTACGCGATAGCACTACATGCAAGTACTTTTGCGGCTACCGT |
| Internal bar code: | GCAATGGCCGCACACGACTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 908 |
| LEAP-Seq percent confirming: | 81.4815 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTGAGCTGAGACAGTTGC |
| Suggested primer 2: | GCACCTTTGTTTCACCGCAT |