Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.034088 |
Chromosome: | chromosome 2 |
Location: | 5473428 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g114200 | CSK3 | (1 of 1) K08815 - tau tubulin kinase [EC:2.7.11.26] (TTBK); Casein kinase-related Ser/Thr kinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCCGGCGCTGCTGGGCCCCGTGTCCCAGCTGAGTCACTACATCGCCA |
Internal bar code: | CTAGGGGTTATGTGTCATTATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1267 |
LEAP-Seq percent confirming: | 97.4359 |
LEAP-Seq n confirming: | 38 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGTACAGGGCTTCAGTGC |
Suggested primer 2: | ATAGAGCTGCTGGAGGGTGA |