Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.034110 |
Chromosome: | chromosome 17 |
Location: | 709940 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g700700 | (1 of 37) IPR008979 - Galactose-binding domain-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTAGTTCGGCCTCAACCTCACGCGGCGCCAGCAAACACACGCACACGCT |
Internal bar code: | CTATTTACCGAATTACTTATTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1630 |
LEAP-Seq percent confirming: | 92.8571 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTGTGTGTGTCTTGGTGC |
Suggested primer 2: | ACCCGCGATTACATCAAGCA |