Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.034143 |
Chromosome: | chromosome 8 |
Location: | 965600 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g362000 | FAP408,FAP72 | Flagellar Associated Membrane Protein 72/408; (1 of 28) PTHR31600//PTHR31600:SF2 - FAMILY NOT NAMED // TINY MACROCYSTS PROTEIN B-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATCCCAGATGTTGGCTCGGTGGTGTCGCCGCCGGCGACATGGTGTTGG |
Internal bar code: | AAGTCTCTTAACTTCAAATATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3788 |
LEAP-Seq percent confirming: | 71.6216 |
LEAP-Seq n confirming: | 53 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGCGTGACGACACTCTCT |
Suggested primer 2: | TACGGTATAACCCCATGCGC |