Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.034200 |
Chromosome: | chromosome 6 |
Location: | 2592183 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g269865 | SMM18 | (1 of 1) IPR000104//IPR029044 - Antifreeze protein, type I // Nucleotide-diphospho-sugar transferases; S-adenosyl-L-methionine-dependent methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTGAACACGCGCCGCGACGTGTCGCGGGTGCATGGTAGTGCTGCGCCG |
Internal bar code: | TTTGTTGGTCGCGGAGGTCGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2046 |
LEAP-Seq percent confirming: | 90.9091 |
LEAP-Seq n confirming: | 30 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGGCTTCAGGAAGTCAGG |
Suggested primer 2: | GGCAAAAGTGGAAGCATGGG |