Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.034289 |
Chromosome: | chromosome 14 |
Location: | 2458427 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g623850 | (1 of 41) IPR000719//IPR011009 - Protein kinase domain // Protein kinase-like domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGAACTTCACGGTGCGAATGGGATGGTGGGCGTCAATCGGCTCGCCGA |
Internal bar code: | ACGTAGCTAGCGGGATTCTACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2067 |
LEAP-Seq percent confirming: | 10.8108 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 66 |
LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCTGGCGAGAAGGTAACAG |
Suggested primer 2: | TGCTGAACAGGTGCAGGTAG |