Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.034374 |
Chromosome: | chromosome 11 |
Location: | 2615993 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095082 | (1 of 4) PF00956 - Nucleosome assembly protein (NAP) (NAP) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTAAGAACTGAAGGCGTAGCCAGGGAGGGTAAAGACTACCAGCCCAAGC |
Internal bar code: | ACTTTTCTGATAAGGTTTGTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 729 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCACACGCAAACAACCACG |
Suggested primer 2: | TGTTTCGCAAGCAACACGAG |