Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.034459 |
Chromosome: | chromosome 5 |
Location: | 3413568 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g233100 | KIN14-6,KIN14B,KIN14B-1 | (1 of 3) K10406 - kinesin family member C2/C3 (KIFC2_3); Kinesin motor protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCGTTGTAGATCTCCAGCATCTGGGCCCTGATGCTGTAGTGCATCTGC |
Internal bar code: | CGGGAGGTGGAATCACGAGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3823 |
LEAP-Seq percent confirming: | 98.8372 |
LEAP-Seq n confirming: | 85 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTTTGACAAGGTGTTCGCC |
Suggested primer 2: | TGGAAGAGCTCAAGCCCATG |