| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.034493 |
| Chromosome: | chromosome 3 |
| Location: | 1838990 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g154400 | MFT15 | Major facilitator superfamily transporter; (1 of 2) PTHR23121:SF9 - SODIUM-DEPENDENT GLUCOSE TRANSPORTER 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGCTGATGTGCCGCTTCCTGCTTGCAGGCCTCCTTCGGCGCCTGGGTG |
| Internal bar code: | AGTCATTTCACGAGCGTCTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4432 |
| LEAP-Seq percent confirming: | 98.6301 |
| LEAP-Seq n confirming: | 72 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTTGTAACCTTTGCAGCA |
| Suggested primer 2: | ACCACCACCACCATCATCAC |