Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.034705 |
Chromosome: | chromosome 13 |
Location: | 5235072 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g607750 | CCDC65,DRC2,FAP250 | Nexin-dynein regulatory complex 2; (1 of 1) PTHR21625:SF0 - COILED-COIL DOMAIN-CONTAINING PROTEIN 65 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACAGCGTAGAGCCGCCAACCCCCAGCACCCCGCACCTGTGCCTTGCGC |
Internal bar code: | TCAGAGCGGGCCCCAGACCTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2309 |
LEAP-Seq percent confirming: | 71.4286 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACAGCAGTGCTTCCTGAGT |
Suggested primer 2: | CTGCATAATGGCGTCCTTGC |