| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.034738 |
| Chromosome: | chromosome 17 |
| Location: | 1335648 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g705700 | PROB1,GGK1 | Glutamate 5-kinase; (1 of 3) 2.7.2.11 - Glutamate 5-kinase / Gamma-glutamyl kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGCACCCCCTGGCCACTCCGCAGCCCCGGGCCCACTGAGCCCCTTGGC |
| Internal bar code: | AACGGCAATGATTGCTCTGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2850 |
| LEAP-Seq percent confirming: | 86.0465 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAACCTTTGTCGCTGTCG |
| Suggested primer 2: | AGCATCATGGTCCTTGCGAA |