| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.034739 |
| Chromosome: | chromosome 11 |
| Location: | 1548175 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g468400 | (1 of 5) PF07466 - Protein of unknown function (DUF1517) (DUF1517) | outside_mRNA | |
| Cre11.g468450 | CEN1,VFL2,DLE2 | 20 kD Calcium-Binding Protein Centrin (caltractin); (1 of 1) K16465 - centrin-1 (CETN1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACTGTAACATTGACCGCGAGTTATCGCGCGCTCGCCCGCGCGTCTTC |
| Internal bar code: | TGTTGTCGAGTTTACAAAGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2522 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTCAAAGTCGATGGTGCC |
| Suggested primer 2: | AGCTTCGATACCGATGGCAG |