| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.034767 |
| Chromosome: | chromosome 14 |
| Location: | 651546 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g612150 | MOT18,PAP10 | Class-II RNA nucleotidyl transferase 10; (1 of 1) K14079 - poly(A) RNA polymerase GLD2 [EC:2.7.7.19] (PAPD4, GLD2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGGGTGCTGCGGTATCCCGCCGGGGAGCTTTCTCCGACTTCACGGAAA |
| Internal bar code: | TATATACGAGCTCCAAACATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1217 |
| LEAP-Seq percent confirming: | 84.2105 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAACTTCACGGATGCGACT |
| Suggested primer 2: | GTACCGGAGTGGAGTGTTGG |