Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.034841 |
Chromosome: | chromosome 9 |
Location: | 1577686 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g399000 | SDR18 | Short-chain dehydrogenase/reductase; (1 of 5) IPR002198//IPR002347//IPR003560//IPR013968 - Short-chain dehydrogenase/reductase SDR // Glucose/ribitol dehydrogenase // 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase // Polyketide synthase, ketoreductase domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGAGAGCGTGGCGCACAAGGTGCAGGTGAGTGGGGGCGTGGGGGCGT |
Internal bar code: | CTGACGGGCTCGGGAGGGCTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1405 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACGTAGTCATCCCGGATG |
Suggested primer 2: | GGGAAACATCACTCAGCGGA |