Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.034865 |
Chromosome: | chromosome 6 |
Location: | 6897133 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g296700 | HYDG1,HYDG | Hydrogenase assembly factor/biotin synthase; (1 of 1) PTHR22976//PTHR22976:SF2 - BIOTIN SYNTHASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATTCATTGTTAAATGGCCATGCACAGGTGCGCGAGATCCTGGCCAAGG |
Internal bar code: | CCTGCACCATCTCGCCAAACCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1788 |
LEAP-Seq percent confirming: | 96.9697 |
LEAP-Seq n confirming: | 64 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTAGATGCGCTCCTTGAT |
Suggested primer 2: | AGCCAGCCCCGAAACATAAA |