| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.034898 |
| Chromosome: | chromosome 7 |
| Location: | 904664 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g800773 | (1 of 1) PF00515//PF07719//PF13414//PF13637 - Tetratricopeptide repeat (TPR_1) // Tetratricopeptide repeat (TPR_2) // TPR repeat (TPR_11) // Ankyrin repeats (many copies) (Ank_4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATGGGGTTTGGCTGTGGCTGTAGCCATGCCTAAGACAGCTCCATCTAA |
| Internal bar code: | TTTATACTGAATAAGGCCTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 873 |
| LEAP-Seq percent confirming: | 80.7692 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGGTGCTACTGCTACTGC |
| Suggested primer 2: | GTCTCTCACTCACTCCCCCT |