| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.034899 |
| Chromosome: | chromosome 10 |
| Location: | 2345761 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g434650 | CTR3 | Copper transport accessory protein; (1 of 1) PTHR12483//PTHR12483:SF27//PTHR12483:SF34 - SOLUTE CARRIER FAMILY 31 COPPER TRANSPORTERS // COPPER TRANSPORTER 1A, ISOFORM C-RELATED // PROTEIN P80 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGAATCAAGGGGGGAGCTGCAACTCGGAAATCTCACCCAGCGGGTTG |
| Internal bar code: | GGGGTTTGTCTAAATGGCTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 843 |
| LEAP-Seq percent confirming: | 7.14286 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCAGAGCTCGCGCAATAG |
| Suggested primer 2: | GTTATGAGGTGCATGCGCTG |