| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.034940 |
| Chromosome: | chromosome 1 |
| Location: | 5979885 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g042450 | (1 of 14) IPR006626//IPR011050 - Parallel beta-helix repeat // Pectin lyase fold/virulence factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTACAGTCTTCGGGTCAACGGCCGGACTCCACAGCAGCTTGTTGCCCG |
| Internal bar code: | CCCTGAGAGGAAGGCCTCCGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1486 |
| LEAP-Seq percent confirming: | 38.0952 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTGAACCCTGCGTGGAAC |
| Suggested primer 2: | CGCAAACGAAGACTGCTAGC |