| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.035062 |
| Chromosome: | chromosome 8 |
| Location: | 1273881 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g363837 | POLG1X,POL1A | (1 of 1) IPR001098//IPR002298//IPR012337 - DNA-directed DNA polymerase, family A, palm domain // DNA polymerase A // Ribonuclease H-like domain; Putative DNA polymerase gamma, organellar | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGAAAATACCAGCCCAAACTAAACCAAAACCTACTAAAAAGAGCGGA |
| Internal bar code: | GGTCGTGCCGGAAATGGCCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1835 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGACATGGACTTTGCGGAT |
| Suggested primer 2: | ACAGATACAGACCCCTCCCC |