| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.035152 |
| Chromosome: | chromosome 2 |
| Location: | 4602951 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g107350 | DHC4 | (1 of 3) IPR003593//IPR004273//IPR011704//IPR013602//IPR024317//IPR024743//IPR026983//IPR027417 - AAA+ ATPase domain // Dynein heavy chain domain // ATPase, dynein-related, AAA domain // Dynein heavy chain, domain-2 // Dynein heavy chain, P-loop containing D4 domain // Dynein heavy chain, coiled coil stalk // Dynein heavy chain // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGAGCTGTGTGCGGAGCTGCTGGCGGTGGGCAGCCGCATCGACATGGA |
| Internal bar code: | GCGTAGGGGGGAGTGTCCATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3061 |
| LEAP-Seq percent confirming: | 97.5 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACTGCACATCAACACCGC |
| Suggested primer 2: | CTGGAAGGGTGGAAGAGCTG |