Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.035210 |
Chromosome: | chromosome 17 |
Location: | 4529656 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g731500 | FAP394 | Flagellar Associated Protein 394; (1 of 1) IPR000157//IPR011050 - Toll/interleukin-1 receptor homology (TIR) domain // Pectin lyase fold/virulence factor | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCACACACGCACATGCTGCCTGGCTGCGGTGCACCCAACCTGACTTCT |
Internal bar code: | TAGGTGAACTTAACTTCGTGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 168 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGTTGTGATGCCCCTGGA |
Suggested primer 2: | CGGGCAAGCGTTTGGATTAG |