| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.035210 |
| Chromosome: | chromosome 17 |
| Location: | 4529656 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g731500 | FAP394 | Flagellar Associated Protein 394; (1 of 1) IPR000157//IPR011050 - Toll/interleukin-1 receptor homology (TIR) domain // Pectin lyase fold/virulence factor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCACACACGCACATGCTGCCTGGCTGCGGTGCACCCAACCTGACTTCT |
| Internal bar code: | TAGGTGAACTTAACTTCGTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 168 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTTGTGATGCCCCTGGA |
| Suggested primer 2: | CGGGCAAGCGTTTGGATTAG |