| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.035240 |
| Chromosome: | chromosome 1 |
| Location: | 5451662 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g038500 | CYP746A1,CYP3 | Cytochrome P450, CYP197 superfamily, CYP197B family; (1 of 3) IPR001128//IPR002397//IPR002401//IPR002403 - Cytochrome P450 // Cytochrome P450, B-class // Cytochrome P450, E-class, group I // Cytochrome P450, E-class, group IV | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCGCCGCCGCCGGCGCCGCCACGCGGCTCCAGCGCCTGTCCTCCCCG |
| Internal bar code: | TGAATTGAGTATTTAGACTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 252 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCAGTAGGGGGTTGGGTGA |
| Suggested primer 2: | TTCTCTGGCGCAAACCCTAG |