| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.035315 |
| Chromosome: | chromosome 16 |
| Location: | 7876117 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689647 | AGO3 | (1 of 2) K11593 - eukaryotic translation initiation factor 2C (ELF2C, AGO); Argonaute-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGGATGGCGTCCAGCGAGGCCGCCGCCTGCGCCGGAGACACCACACCG |
| Internal bar code: | TGCCTGTGACGGCCGTGTAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2377 |
| LEAP-Seq percent confirming: | 71.4286 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCATGCTAAGCACACTCC |
| Suggested primer 2: | GCACACAGCCAAAGAGCAAA |