| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.035350 |
| Chromosome: | chromosome 3 |
| Location: | 3101293 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g164350 | (1 of 1) K06130 - lysophospholipase II (LYPLA2) | intron | |
| Cre03.g800314 | (1 of 77) IPR001623 - DnaJ domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTTAGGGCCAGGCGTTACGTGCTGCCTGCGGCGAGTTGCGCATACTGC |
| Internal bar code: | CCACGCGATGATAATACCAAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1181 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGTCAACAGTTGTGCACC |
| Suggested primer 2: | CCTCCGACTATCCCTTTGGC |