| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.035368 |
| Chromosome: | chromosome 10 |
| Location: | 6043093 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g461750 | DMC5 | Putative DNA methylase; (1 of 1) PF00145//PF12047 - C-5 cytosine-specific DNA methylase (DNA_methylase) // Cytosine specific DNA methyltransferase replication foci domain (DNMT1-RFD) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGAGTTGTTGGGTGGCGGAGCGTGCTGAGGGCCGCAACTGCAATGGC |
| Internal bar code: | TTTAGCGATTTTTTATGTGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2107 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAACATGAAGCAGCCCACC |
| Suggested primer 2: | GTCCTCACTTACCGCACCTC |