Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.035400 |
Chromosome: | chromosome 8 |
Location: | 1963137 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g368300 | HEL43 | Putative RNA helicase; (1 of 4) IPR001650//IPR006935//IPR014001//IPR027417 - Helicase, C-terminal // Helicase/UvrB, N-terminal // Helicase superfamily 1/2, ATP-binding domain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTCAAATCTATCCGCGTGCGTGCAGGACCCCAGCGGCGCGCGCTGCAA |
Internal bar code: | TTGAGTGATGCTGTCGGGTTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2319 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 60 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCGGTACATGAATGGCCTT |
Suggested primer 2: | CATGCGTGCACTGATACTGC |