| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.035467 |
| Chromosome: | chromosome 12 |
| Location: | 8681247 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g547900 | MCP27 | Mitochondrial substrate carrier protein; (1 of 1) PTHR24089:SF242 - MITOCHONDRIAL COENZYME A TRANSPORTER SLC25A42 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCGTAGGCGCACAGGGGGGCGACGAAACCTTTCCTGTACCCACCCAA |
| Internal bar code: | GGCGTGTTATTGGAACCTAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 138 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACGCTTGAGTGCCTCGTA |
| Suggested primer 2: | CATCCCTACCCACACCCAAC |