| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.035469 |
| Chromosome: | chromosome 1 |
| Location: | 348286 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g002050 | APT1 | Acid phosphatase; (1 of 1) K01078 - acid phosphatase (E3.1.3.2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCCTGGTGTCGGCCCGCACCACCAACATCAGCCGCACCATCGCCACCC |
| Internal bar code: | TCCCTACGAGCAGTCTCAGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 245 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCTCCCACCTTTCCATCC |
| Suggested primer 2: | ATGTGTGTGAACGGCAATGC |