| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.035652 |
| Chromosome: | chromosome 2 |
| Location: | 347962 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g075400 | (1 of 6) PTHR15907//PTHR15907:SF21 - FAMILY NOT NAMED // DUF614 FAMILY PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGACCCTTCAGTGCTCGCGGTGCGAGTTGGTGCCTGACCTGTTGTACC |
| Internal bar code: | CGGTAATGGTAGGCATGGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5117 |
| LEAP-Seq percent confirming: | 99.1071 |
| LEAP-Seq n confirming: | 111 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 112 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGCAAGACTACCCCATGT |
| Suggested primer 2: | GTCCAACCTCAACGCAACAC |