Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.035806 |
Chromosome: | chromosome 2 |
Location: | 441793 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g076000 | LAT3,STK1,STPK1,SNRK2K | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase; snRK1 family in Chlamydomonas, subgroup 2; Latrunculin-B sensitive 3 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCAATATCATGCATGGAACCACGCCCCATCCAAACCCCACCCCCCAGC |
Internal bar code: | GTGAGTTATAGGGGACTATGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 474 |
LEAP-Seq percent confirming: | 84.6154 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGGCCTTCATGTTCCTCAG |
Suggested primer 2: | CTGTTTGTTTCTGGGCCTGC |