Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.035917 |
Chromosome: | chromosome 8 |
Location: | 4053695 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g382800 | CDPK13 | (1 of 1) PF00036//PF07714//PF13499 - EF hand (EF-hand_1) // Protein tyrosine kinase (Pkinase_Tyr) // EF-hand domain pair (EF-hand_7); Calcium/calmodulin-dependent protein kinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGGGGCGGCATCAAGGGCACTGCACGATGAGGAGGACGGAGTGCGTGT |
Internal bar code: | GGGTCAACAGTGGCTCTTATCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 828 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGTCGCGGTAGATGATTCC |
Suggested primer 2: | GGTGAAGACCATCCCCAAGG |