Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.035950 |
Chromosome: | chromosome 4 |
Location: | 759327 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g800442 | (1 of 5) PF04937 - Protein of unknown function (DUF 659) (DUF659) | CDS | |
Cre04.g800443 | (1 of 1) IPR007021//IPR012337 - Domain of unknown function DUF659 // Ribonuclease H-like domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGCCTTCATCAGGATGCTGAAGGCGGTCGTCGCGGCGGGCCCGAAGT |
Internal bar code: | ATCTGCCCGTGTGGACACTCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 6408 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 95 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 95 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGCTGGTGAGTTCAAGGA |
Suggested primer 2: | TGGCGCTTGACATGTACTGT |